FastQCFastQC Report
Thu 18 May 2017
NGS13-A521_2T_GCCAAT_L001_R1_001_sample.fq

Summary

[OK]Basic Statistics

MeasureValue
FilenameNGS13-A521_2T_GCCAAT_L001_R1_001_sample.fq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences100000
Sequences flagged as poor quality0
Sequence length101
%GC57

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTT6040.604No Hit
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT4330.43299999999999994No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTC4320.432No Hit
CCAGTAAGTGCGGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGT4050.40499999999999997No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCC3520.35200000000000004No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATA3270.327No Hit
GCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGT3270.327No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGT3260.326No Hit
GGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTG3020.302No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCA2750.27499999999999997No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGT2700.27No Hit
GTTCAAAGCAGGCCCGAGCCGCCTGGATACCGCAGCTAGGAATAATGGAA2700.27No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGC2640.264No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATG2640.264No Hit
GTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCC2590.259No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTC2560.256No Hit
GTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTG2530.253No Hit
GCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGC2530.253No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGA2400.24No Hit
CTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTG2360.23600000000000002No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGA2290.22899999999999998No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCA2270.22699999999999998No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAA2220.22200000000000003No Hit
CTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGC2160.216No Hit
AGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG2120.212No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGA2090.209No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCT2080.208No Hit
GTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACAT2070.207No Hit
CTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCG2060.20600000000000002No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCG2050.20500000000000002No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGG1960.196No Hit
CCATGACCCGCCGGGCAGCTTCCGGGAAACCAAAGTCTTTGGGTTCCGGG1940.194No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGG1880.188No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCA1880.188No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTT1880.188No Hit
GGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAG1840.184No Hit
GCTCTTTCTCGATTCCGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTG1840.184No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCG1820.182No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATT1800.18No Hit
CGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACAC1750.17500000000000002No Hit
GGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTA1730.173No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTC1720.172No Hit
GGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGC1660.166No Hit
GCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATGAACGAG1650.165No Hit
GTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGA1650.165No Hit
CCCAGTAAGTGCGGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTG1630.163No Hit
CGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCTTTTGGG1610.161No Hit
GCTTAATTTGACTCAACACGGGAAACCTCACCCGGCCCGGACACGGACAG1600.16No Hit
GTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGG1590.159No Hit
CAGTAAGTGCGGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTA1570.157No Hit
CTCGATTCCGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGAT1570.157No Hit
CTGACCTTTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGA1530.153No Hit
CCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAG1510.151No Hit
GGGGATTGCAATTATTCCCCATGAACGAGGAATTCCCAGTAAGTGCGGGT1500.15No Hit
GTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGC1490.149No Hit
GCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG1490.149No Hit
CTGGCATGCTAACTAGTTACGCGACCCCCGAGCGGTCGGCGTCCCCCAAC1470.147No Hit
GGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGC1470.147No Hit
GCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCA1460.146No Hit
GTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTA1450.145No Hit
CCGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCTG1440.14400000000000002No Hit
GCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCG1430.14300000000000002No Hit
CCTGCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAG1430.14300000000000002No Hit
GTGCGGACCAGGGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAAG1390.13899999999999998No Hit
GCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAGTGA1390.13899999999999998No Hit
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGT1370.13699999999999998No Hit
CCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTC1350.135No Hit
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGA1350.135No Hit
GTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGA1340.134No Hit
GTTCCTTTGGTCGCTCGCTCCTCTCCTACTTGGATAACTGTGGTAATTCT1330.133No Hit
GCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTG1320.132No Hit
CTTAATTTGACTCAACACGGGAAACCTCACCCGGCCCGGACACGGACAGG1320.132No Hit
GTTTAGTGAGGCCCTCGGATCGGCCCCGCCGGGGTCGGCCCACGGCCCTG1310.131No Hit
GGGGGGAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGC1300.13No Hit
CTCGGATCGGCCCCGCCGGGGTCGGCCCACGGCCCTGGCGGAGCGCTGAG1300.13No Hit
CGTTGATTAAGTCCCTGCCCTTTGTACACACCGCCCGTCGCTACTACCGA1300.13No Hit
GTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTACACACCGCCCGT1290.129No Hit
GGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGG1280.128No Hit
CTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCT1270.127No Hit
GTCCACTTTAAATCCTTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGC1260.126No Hit
GTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGG1260.126No Hit
GGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATT1240.124No Hit
CTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCC1230.123No Hit
CCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAGACCCGACGCACCCC1230.123No Hit
GTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAG1230.123No Hit
CGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGA1230.123No Hit
GTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAAC1220.122No Hit
CAGAAAAGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTC1220.122No Hit
GGGAAACCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCT1220.122No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGG1210.121No Hit
CCGCGGTTCTATTTTGTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGG1200.12No Hit
CAAGAATGTTTTCATTAATCAAGAACGAAAGTCGGAGGTTCGAAGACGAT1200.12No Hit
GGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCT1200.12No Hit
GCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTT1190.11900000000000001No Hit
GTGCGGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTACACACC1170.117No Hit
CCGACTTAGAACTGGTGCGGACCAGGGGAATCCGACTGTTTAATTAAAAC1170.117No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCC1170.117No Hit
CTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGA1160.116No Hit
GGGGAATCCGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCG1150.11499999999999999No Hit
GCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGAT1150.11499999999999999No Hit
CGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG1140.11399999999999999No Hit
CTGGTTGATCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGC1140.11399999999999999No Hit
GGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATA1140.11399999999999999No Hit
GCGGGTCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTGTACACACCGC1140.11399999999999999No Hit
GTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGGGT1130.11299999999999999No Hit
CTCTGATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAG1130.11299999999999999No Hit
GCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCC1110.11100000000000002No Hit
GCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCG1100.11No Hit
GTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGG1100.11No Hit
CGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGGGTTGA1090.109No Hit
GGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCG1090.109No Hit
GTCCGGTGCGGAGTGCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAG1090.109No Hit
CCCGTCGCTACTACCGATTGGATGGTTTAGTGAGGCCCTCGGATCGGCCC1080.108No Hit
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCT1080.108No Hit
GTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCC1060.106No Hit
CAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTAC1060.106No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT1060.106No Hit
GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAG1040.104No Hit
GGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCG1020.10200000000000001No Hit
GGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAG1020.10200000000000001No Hit
CGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGA1020.10200000000000001No Hit
GTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGT1020.10200000000000001No Hit
GGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGT1010.101No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTAGA150.002230975869.9180594-95
AAAATCA150.002230975869.9180594-95
GGCGTAC505.7953002E-966.0652161
GCGTACG505.7953002E-966.0652162
CGTACGG505.840775E-965.999153
GTACGGA505.840775E-965.999154
TACGGAA551.2405508E-859.9992265
CTCTGAT903.6379788E-1252.432711
GGAAGAC654.632966E-850.7685788
TGATCGT957.2759576E-1249.623424
GATCGTT957.2759576E-1249.623425
TCGTTTT957.2759576E-1249.623427
ATCGTTT957.2759576E-1249.623426
GGGGTGA252.9299576E-547.1894476-77
CCTCTCA250.0016736437.71380286-87
GCCGAGC400.00242579134.9590394-95
CGTTTTT1353.274181E-1034.9201858
GCCCTAT851.6916574E-533.3101921
CCCTATC851.6916574E-533.3101922
CTGATCG1703.6379788E-1233.2768823