FastQCFastQC Report
Thu 18 May 2017
r1.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamer1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6862
Sequences flagged as poor quality0
Sequence length101
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[FAIL]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACGA520.757796560769455No Hit
CCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCA480.6995045176333431No Hit
CCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATG390.5683474205770912No Hit
CAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAG310.45176333430486737No Hit
GGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCA310.45176333430486737No Hit
CCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATT260.3788982803847275No Hit
GCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGACCT240.34975225881667155No Hit
CTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGA240.34975225881667155No Hit
CTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGT230.33517924803264354No Hit
CTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATC230.33517924803264354No Hit
GCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT220.3206062372486156No Hit
GTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACT200.2914602156805596No Hit
GCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGG200.2914602156805596No Hit
GGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGACC190.2768872048965316No Hit
GGTCGACCCGTGCGGAGGAGCGAGGAGGAAGGACGCGCGAGGGCCGGGAC190.2768872048965316No Hit
CCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATAT170.2477411833284757No Hit
CTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGC170.2477411833284757No Hit
GTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGA160.2331681725444477No Hit
GGTCGATGCGTGGAGTGGACGGAGCAAGCTCCTATTCCATCTCCTATTTC160.2331681725444477No Hit
GACGGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAG160.2331681725444477No Hit
GCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGAT150.2185951617604197No Hit
CCCGTCCCGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGGCCACCCGGGG150.2185951617604197No Hit
CCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTG140.20402215097639173No Hit
CGGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGC140.20402215097639173No Hit
GGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAG140.20402215097639173No Hit
GGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCG140.20402215097639173No Hit
GTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACT140.20402215097639173No Hit
CTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGT130.18944914019236375No Hit
GCTGCAGGTCGACCCGTGCGGAGGAGCGAGGAGGAAGGACGCGCGAGGGC130.18944914019236375No Hit
CTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAAATGGACCTT120.17487612940833577No Hit
GTCTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGA120.17487612940833577No Hit
CCACAAATTATGCAGTCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTC120.17487612940833577No Hit
CGGGGATGGTCGTCCTCTTCGACCGAGCGCGCAGCTTCGGGAGGGACGCA120.17487612940833577No Hit
CCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCC110.1603031186243078No Hit
CTCGACACAAGGGTTTGTCCGCGCGCGCGCGCGCGCGTGCGTGCGGGGGG110.1603031186243078No Hit
CACAAATTATGCAGTCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCA110.1603031186243078No Hit
ACTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAACG110.1603031186243078No Hit
CCCGTGCGGAGGAGCGAGGAGGAAGGACGCGCGAGGGCCGGGACCCCGGG110.1603031186243078No Hit
CCGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGGCCACCCGGGGTCCCGG100.1457301078402798No Hit
CCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATCCCACTACTGATC100.1457301078402798No Hit
GTCCCCGTCCCGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGGCCACCCG100.1457301078402798No Hit
GTCTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTCCTACAAATGGACC100.1457301078402798No Hit
ACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCTG100.1457301078402798No Hit
GTCGACCCGTGCGGAGGAGCGAGGAGGAAGGACGCGCGAGGGCCGGGACC100.1457301078402798No Hit
GTCGATGCGTGGAGTGGACGGAGCAAGCTCCTATTCCATCTCCTATTTCC100.1457301078402798No Hit
CCCGCCGGTCCCCGTCCCGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGG90.1311570970562518No Hit
GGCGGAGGAGAGTAGTCTGAATTGGGTTATGAGGTCCCCTGCGGGGTACC90.1311570970562518No Hit
CTCGCTATGTTGCCCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATC90.1311570970562518No Hit
CTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCGATC90.1311570970562518No Hit
CTGGTGGTCCCCCGCTCCCGGGAGGTCACCATATTGATGCCGAACTTAGT90.1311570970562518No Hit
GGAGCGAGGAGGAAGGACGCGCGAGGGCCGGGACCCCGGGTGGCCGCCCC80.11658408627222384No Hit
CCTGGAAGTACTGCAATACCAGGTCGATGCGTGGAGTGGACGGAGCAAGC80.11658408627222384No Hit
CGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGGCCACCCGGGGTCCCGGC80.11658408627222384No Hit
GCCGAACTTAGTGCGGACACCCGATCGGCATAGCGCACTACAGCCCAGAA80.11658408627222384No Hit
GCCCGTGGCCCGCCGGTCCCCGTCCCGGGGGTTGGCCGCGCGGGCCCCGG80.11658408627222384No Hit
GCCGGTTCACCCCTCCTTAGGCAACCTGGTGGTCCCCCGCTCCCGGGAGG80.11658408627222384No Hit
GTGGCTATTCACAGGCGCGATCCCACTACTGATCAGCACGGGAGTTTTGA80.11658408627222384No Hit
CACTCAGACCGCGTTCTCTCCCTCTCACTCCCCAATACGGAGAGAAGAAC80.11658408627222384No Hit
CTACTGATCAGCACGGGAGTTTTGACCTGCTCCGTTTCCGACCTGGGCCG70.10201107548819587No Hit
GGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGGCTATTCACAGGCGCG70.10201107548819587No Hit
CCCGGGGGTTGGCCGCGCGGGCCCCGGTGGGGCGGCCACCCGGGGTCCCG70.10201107548819587No Hit
CACTACTGATCAGCACGGGAGTTTTGACCTGCTCCGTTTCCGACCTGGGC70.10201107548819587No Hit
GGAGTTTTGACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTA70.10201107548819587No Hit
CTTGACCGAAGACCGGTCCTCCTCTATCGGGGATGGTCGTCCTCTTCGAC70.10201107548819587No Hit
CTCCTCTATCGGGGATGGTCGTCCTCTTCGACCGAGCGCGCAGCTTCGGG70.10201107548819587No Hit
CTCATTTGGATGTGTCTGGAGTCTTGGAAGCTTGACTACCCTACGTTCTC70.10201107548819587No Hit
GACCTGCTCCGTTTCCGACCTGGGCCGGTTCACCCCTCCTTAGGCAACCT70.10201107548819587No Hit
CGAGGAGGAAGGACGCGCGAGGGCCGGGACCCCGGGTGGCCGCCCCACCG70.10201107548819587No Hit

[WARN]Adapter Content

Adapter graph

[OK]Kmer Content

No overrepresented Kmers